Genetic and environmental influences on human height from infancy through adulthood at different levels of parental education.

Genetic factors explain a major proportion of human height variation, but differences in mean stature have also been found between socio-economic categories suggesting a possible effect of environment. By utilizing a classical twin design which allows decomposing the variation of height into genetic and environmental components, we tested the hypothesis that environmental variation in height is greater in offspring of lower educated parents.

Twin data from 29 cohorts including 65,978 complete twin pairs with information on height at ages 1 to 69 years and on parental education were pooled allowing the analyses at different ages and in three geographic-cultural regions (Europe, North America and Australia, and East Asia). Parental education mostly showed a positive association with offspring height, with significant associations in mid-childhood and from adolescence onwards. In variance decomposition modeling, the genetic and environmental variance components of height did not show a consistent relation to parental education.

A random-effects meta-regression analysis of the aggregate-level data showed a trend towards greater shared environmental variation of height in low parental education families. In conclusion, in our very large dataset from twin cohorts around the globe, these results provide only weak evidence for the study hypothesis.

Chicken C Reactive Protein (CRP) ELISA Kit
DLR-CRP-Ch-48T	DL Develop	48T	EUR 508
Should the Chicken C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Chicken C Reactive Protein (CRP) ELISA Kit
DLR-CRP-Ch-96T	DL Develop	96T	EUR 661
Should the Chicken C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Human C Reactive Protein (CRP) ELISA Kit
DLR-CRP-Hu-48T	DL Develop	48T	EUR 385
Should the Human C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, urine, cerebrospinal fluid, cell culture supernates or other biological fluids.

Human C Reactive Protein (CRP) ELISA Kit
DLR-CRP-Hu-96T	DL Develop	96T	EUR 492
Should the Human C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, urine, cerebrospinal fluid, cell culture supernates or other biological fluids.

Mouse C Reactive Protein (CRP) ELISA Kit
DLR-CRP-Mu-48T	DL Develop	48T	EUR 489
Should the Mouse C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse C Reactive Protein (CRP) ELISA Kit
DLR-CRP-Mu-96T	DL Develop	96T	EUR 635
Should the Mouse C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine C Reactive Protein (CRP) ELISA Kit
DLR-CRP-p-48T	DL Develop	48T	EUR 547
Should the Porcine C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine C Reactive Protein (CRP) ELISA Kit
DLR-CRP-p-96T	DL Develop	96T	EUR 715
Should the Porcine C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat C Reactive Protein (CRP) ELISA Kit
DLR-CRP-Ra-48T	DL Develop	48T	EUR 426
Should the Rat C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat C Reactive Protein (CRP) ELISA Kit
DLR-CRP-Ra-96T	DL Develop	96T	EUR 549
Should the Rat C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rabbit C Reactive Protein (CRP) ELISA Kit
DLR-CRP-Rb-48T	DL Develop	48T	EUR 508
Should the Rabbit C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Rabbit C Reactive Protein (CRP) ELISA Kit
DLR-CRP-Rb-96T	DL Develop	96T	EUR 661
Should the Rabbit C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Bovine C Reactive Protein (CRP) ELISA Kit
RDR-CRP-b-48Tests	Reddot Biotech	48 Tests	EUR 580

Bovine C Reactive Protein (CRP) ELISA Kit
RDR-CRP-b-96Tests	Reddot Biotech	96 Tests	EUR 807

Chicken C Reactive Protein (CRP) ELISA Kit
RDR-CRP-Ch-48Tests	Reddot Biotech	48 Tests	EUR 534

Chicken C Reactive Protein (CRP) ELISA Kit
RDR-CRP-Ch-96Tests	Reddot Biotech	96 Tests	EUR 742

Human C Reactive Protein (CRP) ELISA Kit
RDR-CRP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 388

Human C Reactive Protein (CRP) ELISA Kit
RDR-CRP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 533

Mouse C Reactive Protein (CRP) ELISA Kit
RDR-CRP-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511

Mouse C Reactive Protein (CRP) ELISA Kit
RDR-CRP-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709

Porcine C Reactive Protein (CRP) ELISA Kit
RDR-CRP-p-48Tests	Reddot Biotech	48 Tests	EUR 580

Porcine C Reactive Protein (CRP) ELISA Kit
RDR-CRP-p-96Tests	Reddot Biotech	96 Tests	EUR 807

Rat C Reactive Protein (CRP) ELISA Kit
RDR-CRP-Ra-48Tests	Reddot Biotech	48 Tests	EUR 437

Rat C Reactive Protein (CRP) ELISA Kit
RDR-CRP-Ra-96Tests	Reddot Biotech	96 Tests	EUR 603

Rabbit C Reactive Protein (CRP) ELISA Kit
RDR-CRP-Rb-48Tests	Reddot Biotech	48 Tests	EUR 534

Rabbit C Reactive Protein (CRP) ELISA Kit
RDR-CRP-Rb-96Tests	Reddot Biotech	96 Tests	EUR 742

Bovine C Reactive Protein (CRP) ELISA Kit
RD-CRP-b-48Tests	Reddot Biotech	48 Tests	EUR 555

Bovine C Reactive Protein (CRP) ELISA Kit
RD-CRP-b-96Tests	Reddot Biotech	96 Tests	EUR 771

Chicken C Reactive Protein (CRP) ELISA Kit
RD-CRP-Ch-48Tests	Reddot Biotech	48 Tests	EUR 511

Chicken C Reactive Protein (CRP) ELISA Kit
RD-CRP-Ch-96Tests	Reddot Biotech	96 Tests	EUR 709

Human C Reactive Protein (CRP) ELISA Kit
RD-CRP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 372

Human C Reactive Protein (CRP) ELISA Kit
RD-CRP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 510

Mouse C Reactive Protein (CRP) ELISA Kit
RD-CRP-Mu-48Tests	Reddot Biotech	48 Tests	EUR 489

Mouse C Reactive Protein (CRP) ELISA Kit
RD-CRP-Mu-96Tests	Reddot Biotech	96 Tests	EUR 677

Porcine C Reactive Protein (CRP) ELISA Kit
RD-CRP-p-48Tests	Reddot Biotech	48 Tests	EUR 555

Porcine C Reactive Protein (CRP) ELISA Kit
RD-CRP-p-96Tests	Reddot Biotech	96 Tests	EUR 771

Rat C Reactive Protein (CRP) ELISA Kit
RD-CRP-Ra-48Tests	Reddot Biotech	48 Tests	EUR 419

Rat C Reactive Protein (CRP) ELISA Kit
RD-CRP-Ra-96Tests	Reddot Biotech	96 Tests	EUR 577

Rabbit C Reactive Protein (CRP) ELISA Kit
RD-CRP-Rb-48Tests	Reddot Biotech	48 Tests	EUR 511

Rabbit C Reactive Protein (CRP) ELISA Kit
RD-CRP-Rb-96Tests	Reddot Biotech	96 Tests	EUR 709

Guinea pig C Reactive Protein (CRP) ELISA Kit
DLR-CRP-Gu-48T	DL Develop	48T	EUR 527
Should the Guinea pig C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Guinea pig C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Guinea pig C Reactive Protein (CRP) ELISA Kit
DLR-CRP-Gu-96T	DL Develop	96T	EUR 688
Should the Guinea pig C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Guinea pig C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Guinea pig C Reactive Protein (CRP) ELISA Kit
RDR-CRP-Gu-48Tests	Reddot Biotech	48 Tests	EUR 557

Guinea pig C Reactive Protein (CRP) ELISA Kit
RDR-CRP-Gu-96Tests	Reddot Biotech	96 Tests	EUR 774

Guinea pig C Reactive Protein (CRP) ELISA Kit
RD-CRP-Gu-48Tests	Reddot Biotech	48 Tests	EUR 533

Guinea pig C Reactive Protein (CRP) ELISA Kit
RD-CRP-Gu-96Tests	Reddot Biotech	96 Tests	EUR 740

CRP C-Reactive Protein Human
PROTP02741-1	BosterBio	Regular: 1mg	EUR 317
Description: Human CRP produced in Human plasma having a molecular mass of 114 kDa. ;It can be used as a marker for inflammation and also used for monitoring and prediction of future events in coronary artery disease.

TruStrip RDT Dog C-reactive Protein (CRP) Rapid Test cards, 10 tests/pack
CRP-RDT-D10	Alpha Diagnostics	1 pack	EUR 171

TruStrip RDT Human C-reactive Protein (CRP) Rapid Test cards, 10 tests/pack
CRP-RDT-H10	Alpha Diagnostics	1 pack	EUR 171

TruStrip RDT Human C-reactive Protein (CRP) Rapid Test cards, 25 tests/pack
CRP-RDT-H25	Alpha Diagnostics	1 pack	EUR 293

TruStrip RDT Monkey C-reactive Protein (CRP) Rapid Test cards, 10 tests/pack
CRP-RDT-M10	Alpha Diagnostics	1 pack	EUR 171

TruStrip RDT Monkey C-reactive Protein (CRP) Rapid Test cards, 25 tests/pack
CRP-RDT-M25	Alpha Diagnostics	1 pack	EUR 293

TruStrip RDT Rat C-reactive Protein (CRP) Rapid Test cards, 10 tests/pack
CRP-RDT-R10	Alpha Diagnostics	1 pack	EUR 171

TruStrip RDT Rat C-reactive Protein (CRP) Rapid Test cards, 25 tests/pack
CRP-RDT-R25	Alpha Diagnostics	1 pack	EUR 293

Anti-C Reactive Protein/Crp Antibody
A00249-1	BosterBio	100ug/vial	EUR 334

CRP C-Reactive Protein Rat Recombinant Protein
PROTP48199-1	BosterBio	Regular: 10ug	EUR 317
Description: CRP produced in Sf9 Insect cells is a single, glycosylated polypeptide chain containing 217 amino acids (20-230 a.a.) and having a molecular mass of 24.1kDa. (Molecular size on SDS-PAGE will appear at approximately 28-40 kDa).;CRP is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

Human C-Reactive Protein (CRP) AssayMax ELISA Kit
EC1001-1	AssayPro	96 Well Plate	EUR 396

Rat C-Reactive Protein (CRP) AssayMax ELISA Kit
ERC1001-1	AssayPro	96 Well Plate	EUR 396

Mouse C-Reactive Protein (CRP) AssayMax ELISA Kit
EMC1001-1	AssayPro	96 Well Plate	EUR 396

CRP/ Rat CRP ELISA Kit
ELA-E0829r	Lifescience Market	96 Tests	EUR 886

Crp/ Rat Crp ELISA Kit
ELI-02799r	Lifescience Market	96 Tests	EUR 886

Canine CRP(CRP) ELISA Kit
QY-E70170	Qayee Biotechnology	96T	EUR 426

CRP siRNA
20-abx901269	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CRP Antibody
BF0116	Affbiotech	200ul	EUR 376
Description: CRP antibody detects endogenous levels of total CRP.

CRP Antigen
E64C00501	EnoGene	1mg	EUR 700

CRP Antigen
E64C00502	EnoGene	1mg	EUR 700

CRP Protein
abx069766-50ml	Abbexa	50 ml	EUR 1205
Shipped within 5-10 working days.

CRP siRNA
20-abx912842	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CRP siRNA
20-abx912843	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CRP Antiboday
70R-51961	Fitzgerald	100 ug	EUR 197
Description: Purified Rabbit CRP antibody

CRP protein
80R-4350	Fitzgerald	50 ug	EUR 349
Description: Purified Recombinant CRP protein (His tagged)

CRP antibody
70R-4527	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal CRP antibody raised against the N terminal of CRP

CRP Antibody
ABD6027	Lifescience Market	100 ug	EUR 438

CRP antibody
10C-CR2015M1	Fitzgerald	1 mg	EUR 168
Description: Mouse monoclonal CRP antibody

CRP antibody
10C-CR2015M5	Fitzgerald	1 mg	EUR 165
Description: Mouse monoclonal CRP antibody

CRP antibody
10C-CR2015M6	Fitzgerald	1 mg	EUR 165
Description: Mouse monoclonal CRP antibody

CRP antibody
10R-10264	Fitzgerald	50 ug	EUR 241
Description: Mouse monoclonal CRP antibody

CRP antibody
10R-1042	Fitzgerald	100 ul	EUR 349
Description: Mouse monoclonal CRP antibody

CRP antibody
10-2276	Fitzgerald	100 ug	EUR 221
Description: Recombinant Fab monoclonal CRP antibody

CRP antibody
10-2349	Fitzgerald	1 mg	EUR 349
Description: Mouse monoclonal CRP antibody

CRP antibody
10-2350	Fitzgerald	1 mg	EUR 349
Description: Mouse monoclonal CRP antibody

CRP antibody
10-2703	Fitzgerald	1 mg	EUR 165
Description: Mouse Monoclonal CRP antibody

CRP antibody
10-7893	Fitzgerald	1 mg	EUR 392
Description: Mouse monoclonal CRP antibody

CRP antibody
10-7894	Fitzgerald	1 mg	EUR 403
Description: Mouse monoclonal CRP antibody

CRP antibody
10-C189A	Fitzgerald	1 mg	EUR 245
Description: Mouse monoclonal CRP antibody

CRP antibody
10-C189B	Fitzgerald	1 mg	EUR 420
Description: Mouse monoclonal CRP antibody

CRP antibody
10-C33A	Fitzgerald	1 mg	EUR 238
Description: Mouse monoclonal CRP antibody

CRP antibody
10-C33AS	Fitzgerald	1 mg	EUR 235
Description: Mouse monoclonal CRP antibody

CRP antibody
10-C33B	Fitzgerald	1 mg	EUR 662
Description: Mouse monoclonal CRP antibody

CRP antibody
10-C33C	Fitzgerald	1 mg	EUR 245
Description: Mouse monoclonal CRP antibody

CRP antibody
10R-8426	Fitzgerald	100 ul	EUR 393
Description: Mouse monoclonal CRP antibody

CRP antibody
10-1004	Fitzgerald	1 mg	EUR 457
Description: Mouse monoclonal CRP antibody

CRP antibody
10R-C189a	Fitzgerald	1 mg	EUR 284
Description: Mouse monoclonal CRP antibody

CRP antibody
10R-C189b	Fitzgerald	1 mg	EUR 399
Description: Mouse monoclonal CRP antibody

CRP protein
30C-CP1000U	Fitzgerald	1 mg	EUR 349
Description: Purified native Human CRP protein

CRP protein
30R-2081	Fitzgerald	100 ug	EUR 322
Description: Recombinant human CRP protein

CRP protein
30R-2389	Fitzgerald	250 ug	EUR 152
Description: Purified recombinant Human CRP protein

CRP protein
30R-2740	Fitzgerald	10 ug	EUR 341
Description: Purified recombinant Human CRP protein

CRP protein
30R-2984	Fitzgerald	1 mg	EUR 380
Description: Purified recombinant Human CRP protein

CRP Protein
30R-3412	Fitzgerald	1 mg	EUR 300
Description: Human C-reactive protein

CRP protein
30R-AC001x	Fitzgerald	10 mg	EUR 457
Description: Highly purifed Human CRP protein

CRP protein
30R-AC067	Fitzgerald	1 mg	EUR 448
Description: Purified native Human CRP protein

CRP Antibody
31062-100ul	SAB	100ul	EUR 252

CRP Antibody
31062-50ul	SAB	50ul	EUR 187

CRP protein
30-1092	Fitzgerald	1 mg	EUR 393
Description: Purified recombinant Human CRP protein

CRP protein
30-1094	Fitzgerald	100 ug	EUR 155
Description: Purified native Human CRP protein

CRP protein
30-1906	Fitzgerald	1 mg	EUR 336
Description: Native human CRP protein

CRP protein
30-AC05	Fitzgerald	5 mg	EUR 277
Description: Highly purified Human CRP protein

CRP protein
30-AC07	Fitzgerald	5 mg	EUR 1029
Description: Purified Recombinant CRP protein

CRP protein
30-AC10	Fitzgerald	5 mg	EUR 250
Description: Partially purified Human CRP protein

CRP Antibody
32023-100ul	SAB	100ul	EUR 252

CRP antibody
10R-3002	Fitzgerald	100 ug	EUR 265
Description: Mouse monoclonal CRP antibody

CRP antibody
20C-CR2015S	Fitzgerald	1 ml	EUR 133
Description: Sheep polyclonal CRP antibody

CRP antibody
20C-CR2015SP	Fitzgerald	1 ml	EUR 177
Description: Sheep polyclonal CRP antibody

CRP antibody
20-1002	Fitzgerald	1 ml	EUR 111
Description: Goat polyclonal Human CRP antibody

CRP antibody
20-1003	Fitzgerald	1 ml	EUR 133
Description: Rabbit polyclonal Human CRP antibody

CRP antibody
20-1262	Fitzgerald	1 ml	EUR 647
Description: Sheep polyclonal CRP antibody

CRP antibody
20-B9007G000-W0	Fitzgerald	10 ml	EUR 116
Description: Goat polyclonal Human CRP antibody

CRP antibody
20-B9007GD00-D0	Fitzgerald	5 mg	EUR 138
Description: Goat polyclonal Human CRP antibody

CRP antibody
20-S3903GND1-D0	Fitzgerald	1 ml	EUR 133
Description: Polyclonal CRP antibody

CRP antibody
20-S3903GND9-D0	Fitzgerald	10 ml	EUR 127
Description: Goat polyclonal Human CRP antibody

CRP antibody
20-S3911G000-S4	Fitzgerald	10 ml	EUR 116
Description: Goat polyclonal Human CRP antibody

CRP antibody
20-S3911G000-V0	Fitzgerald	10 ml	EUR 133
Description: Goat polyclonal Human CRP antibody

CRP antibody
20-S3911G001-V0	Fitzgerald	10 ml	EUR 133
Description: Goat polyclonal Human CRP antibody

CRP antibody
20-S6011G000-S4	Fitzgerald	10 ml	EUR 138
Description: Goat polyclonal CRP antibody

CRP Antibody
6690-100	Biovision		EUR 338

CRP Antibody
6690-30T	Biovision		EUR 146

CRP antibody
70R-13710	Fitzgerald	100 ug	EUR 322
Description: Affinity purified Sheep polyclonal CRP antibody

CRP antibody
70-B9007GA00-A0	Fitzgerald	5 mg	EUR 241
Description: Goat polyclonal Human CRP antibody

CRP antibody
70R-10663	Fitzgerald	1 ml	EUR 484
Description: Rabbit polyclonal CRP antibody

CRP Antibody
DF6027	Affbiotech	200ul	EUR 304
Description: CRP Antibody detects endogenous levels of total CRP.

CRP Antibody
1-CSB-PA005116	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CRP. Recognizes CRP from Human, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

CRP Antibody
1-CSB-PA790121	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CRP. Recognizes CRP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

crp Antibody
1-CSB-PA359785LA01ENV	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against crp. Recognizes crp from Escherichia coli. This antibody is Unconjugated. Tested in the following application: ELISA

CRP Antibody
1-CSB-PA181901	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CRP. Recognizes CRP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:100-1:300

CRP Antibody
1-CSB-PA06079A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CRP. Recognizes CRP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

anti-CRP
YF-PA27200	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to CRP

hs-CRP/ Rat hs- CRP ELISA Kit
ELA-E0821r	Lifescience Market	96 Tests	EUR 886

Polyclonal CRP Antibody
APG02787G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CRP . This antibody is tested and proven to work in the following applications:

Large-CRP OmcBProtein
20-abx600013	Abbexa	EUR 843.00 EUR 439.00 EUR 1274.00 EUR 1636.00 EUR 551.00	100 ug 10 ug 200 ug 500 ug 50 ug
Shipped within 1 month.

Large-CRP OmcBProtein
20-abx600014	Abbexa	EUR 2764.00 EUR 1734.00	100 ug 50 ug
Shipped within 3 months.

CRP Blocking Peptide
BF0116-BP	Affbiotech	1mg	EUR 195

CRP Conjugated Antibody
C31062	SAB	100ul	EUR 397

CRP Conjugated Antibody
C32023	SAB	100ul	EUR 397

CRP cloning plasmid
CSB-CL005991HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 276 Sequence: atggagaagctgttgtgtttcttggtcttgaccagcctctctcatgcttttggccagacagacatgtcgaggaaggcttttgtgtttcccaaagagtcggatacttcctatgtatccctcaaagcaccgttaacgaagcctctcaaagccttcactgtgtgcctccacttctacac Show more
Description: A cloning plasmid for the CRP gene.

CRP cloning plasmid
CSB-CL005991HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 141 Sequence: atgtgggactttgtgctgtcaccagatgagattaacaccatctatcttggcgggcccttcagtcctaatgtcctgaactggcgggcactgaagtatgaagtgcaaggcgaagtgttcaccaaaccccagctgtggccctga
Description: A cloning plasmid for the CRP gene.

CRP cloning plasmid
CSB-CL005991HU3-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 675 Sequence: ATGGAGAAGCTGTTGTGTTTCTTGGTCTTGACCAGCCTCTCTCATGCTTTTGGCCAGACAGACATGTCGAGGAAGGCTTTTGTGTTTCCCAAAGAGTCGGATACTTCCTATGTATCCCTCAAAGCACCGTTAACGAAGCCTCTCAAAGCCTTCACTGTGTGCCTCCACTTCTACAC Show more
Description: A cloning plasmid for the CRP gene.

anti- CRP antibody
FNab01994	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IF: 1:50 - 1:200 Immunogen: C-reactive protein, pentraxin-related Uniprot ID: P02741 Gene ID: 1401 Research Area: Immunology, Cardiovascular
Description: Antibody raised against CRP

anti- CRP antibody
FNab01995	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:1000-1:4000 IHC: 1:50-1:500 Immunogen: C-reactive protein, pentraxin-related Uniprot ID: P02741 Gene ID: 1401 Research Area: Immunology, Cardiovascular
Description: Antibody raised against CRP

CRP Polyclonal Antibody
ES3926-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CRP from Human/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA